Denne underside hører til Biotech Academy’s gymnasie projekt Bioinformatik – En introduktion

Virtual Ribosome

Oversigt over brug af værktøjet

Virtual Ribosome er et online program, der benyttes til at translatere (oversætte) DNA-sekvenser til protein (find det her). I øvelse 1a – Aktin, fra mRNA til tredimensionelt protein arbejdes med Virtual Ribosome.

Input

DNA-sekvens der skal translateres til et protein.

Output

En aminosyresekvens der er dannet på baggrund af den bedste læseramme.

Beskrivelse

Virtual Ribosome bruges til at translatere DNA-sekvenser til proteinsekvenser. Ud over den direkte translation bruges Virtual Ribosome også til at analysere de seks mulige læserammer, da programmet kan finde den mest sandsynlige læseramme for DNA-sekvensen. Hvis man har en ukendt DNA-sekvens, er analysen af læserammer en stor fordel, da man ved at undersøge dem for den åbne læseramme kan finde protein-kodende gener i sekvenserne.

Figur 36. Startsiden for Virtual Ribosome.

Generel guide

Når man går til internetsiden for Virtual Ribosome, kommer man direkte ind på den startside, som kan ses i figur 36. Den DNA-sekvens, man ønsker at translatere, indtastes i felt 1 på figur 36, og den kan indtastes både med og uden “header” (se nedenfor).

En DNA-sekvens med header ser ud som nedenfor. Det er vigtigt at huske at skifte til en ny linje mellem headeren og selve nukleotid-sekvensen, da linjen adskiller dem:

>protein 1 (header)
AATGTGGACCTCAGTTGACTAGCAGTTAGGAGCACAGATGACAGTA

Et eksempel på en DNA-sekvens uden header:
ACCGGATGCGTAACAGATAGGGCACCCATGATGACGAACGTATAG

Sekvenser med headere af denne type kaldes for FASTA-filer.

Hvis der ikke ændres på parametrene, inden man kører Virtual Ribosome er det standardindstillingerne, der bliver brugt til translationen. Disse er følgende:

  • Læseramme 1 benyttes, dvs. det er position 1 på den viste (positive) DNA-streng, der er det første nukleotid, som aflæses. Valg af læseramme kan ændres i felt 2 i figur 36 til den læse- eller de læserammer, man ønsker at bruge.
  • Der er ingen specificeret startcodon, dvs. at hele DNA-sekvensen oversættes til aminosyrer og ikke kun den åbne læseramme (mellem start- og stopcodon). Valg af den åbne læseramme ændres i felt 3 i figur 36.
    Det anbefales, at der ændres til “Start codon: Strict”. Dette betyder, at man tvinger translationen til at starte ved startcodonen ATG. Det er den mest udbredte startcodon, og derfor også den codon der starter langt de fleste åbne læserammer.

For at starte translationen skal man trykke på Submit query.

Et output for Virtual Ribosome kan ses i figur 37. Som det fremgår af figuren kan man se både DNA- og proteinsekvenser, hvor proteinsekvensen er den øverste. I eksemplet i figur 37 er der kun benyttet én læseramme. Hvis der havde været benyttet flere læserammer ville disse være ”stablet” oven på hinanden.De tre læserammer, der tilhører den positive DNA-streng, ville således være over DNA-sekvensen, og de tre, der tilhører den negative DNA-streng, ville være under DNA-sekvensen i baglæns aminosyrerækkefølge.

Hvis man vil gemme den translaterede proteinsekvens, kan man højreklikke på FASTA og trykke “Gem som”. Proteinsekvensen bliver da gemt i FASTA-format.

Figur 37.  Eksempel på et output fra Virtual Ribosome.